Notícias Agrícolas - AF News

Última atualização: 13/6/2018 - Atualizado em 02/10/2013h46

Brasileiros encontram genes responsáveis pela produção de açúcar na cana

Brasileiros encontram genes responsáveis pela produção de açúcar na cana....

De AF News Análises

Se você já tentou encarar um livrão como Guerra e Paz e se desanimou com as 1,3 mil páginas de realismo russo, nem tente ler o DNA da cana-de-açúcar. O dito cujo tem 10 bilhões de pares de bases – isto é, de letras de DNA. Se você imprimir tudo em Times New Roman, tamanho 12, espaçamento 1,15, terá em mãos 4,3 milhões de folhas de papel A4. As 32 mil páginas da Encyclopædia Britannica não chegam nem aos pés.

Ler Tolstói, para muitos acadêmicos, é um trabalho de anos. Ler o genoma da cana-de-açúcar, também. Ela é uma das commodities mais importantes da economia brasileira. Na última safra, foram produzidas 657,2 milhões de toneladas – a Índia, segundo lugar mundial, comeu poeira. Conhecer esse vegetal de perto – perto mesmo, em escala molecular – pode abrir caminho para ajustes genéticos finos que aumentem sua produtividade e sua resistência a doenças.

Em 28 de março, Anete Pereira de Souza, geneticista da Universidade Estadual de Campinas (Unicamp), deu um passo inédito nesse caminho: em um artigo científico, assinado em parceria com quatro colegas, ela usou uma técnica inovadora para identificar um longo trecho de DNA da cana que é muito importante na produção de açúcar. Com essa informação em mãos, fica muito mais fácil buscar variedades novas e mais doces do vegetal sem dar tiros no escuro.

Revisão rápida: as informações necessárias para construir e operar os seres vivos estão armazenadas em longas cadeias de componentes químicos (as tais bases nitrogenadas, para que gosta de jargão) chamados adenina, tiamina, citosina e guanina. Para facilitar, eles são identificados pela primeira letra de seus nomes – A, T, C e G. Você já deve ter em mente a imagem clássica da molécula de DNA: uma escadinha espiralada. Uma representação digital dele, porém – que leva em conta só a informação, e não a estrutura química – é algo mais ou menos assim: “ATCGGGTTTCGTCGAACAGTCTG etc.”

No quesito tamanho, o DNA da cana, com seus 10 bilhões de letrinhas, dá um baile no ser humano, que tem “só” 3,2 bilhões. É bom deixar claro que um DNA comprido não é sinônimo de organismo mais ou menos complexo. O genoma conta a história evolutiva da espécie, mas seu tamanho em bits não tem, necessariamente, relação com o tamanho ou a inteligência do ser que o carrega. Para entender a estratégia que a equipe brasileira usou para driblar o DNA extra-grande do vegetal – e chegar aos genes que mais interessam –, o primeiro passo é entender como a cana se tornou essa verdadeira enciclopédia.

Fonte: Super interessante
veja também
informativo - assinatura
O cadastro é rápido, fácil e você passa a ter acesso a
benefícios exclusivos: Receber as diversas newsletters,
comentar as materias publicadas e balanços semanais.